Variant Gene DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs141970897
rs141970897
0.925 0.200 9 129104269 missense variant T/C snv 1.1E-03 7.8E-04
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 1.000 1 2020 2020
dbSNP: rs762425351
rs762425351
0.925 0.200 9 129095573 missense variant C/T snv 1.2E-04 7.7E-05
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 1.000 1 2020 2020
dbSNP: rs1557043622
rs1557043622
0.695 0.400 X 48909843 missense variant C/A snv
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 1.000 1 2019 2019
dbSNP: rs1562846694
rs1562846694
0.763 0.320 7 100643252 inframe deletion TTCGCTCCACGCACT/- delins
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 1.000 1 2019 2019
dbSNP: rs121918460
rs121918460
0.708 0.400 12 112450364 missense variant T/A;G snv 4.0E-06
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 1.000 1 2018 2018
dbSNP: rs867410737
rs867410737
0.708 0.440 19 1242559 missense variant C/T snv 6.7E-06
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 1.000 1 2018 2018
dbSNP: rs1057519566
rs1057519566
0.851 0.160 7 76063579 missense variant C/T snv
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 1.000 1 2017 2017
dbSNP: rs1554389088
rs1554389088
0.807 0.160 7 44243526 missense variant G/A snv
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 1.000 1 2017 2017
dbSNP: rs1555639076
rs1555639076
0.790 0.400 17 67893677 splice donor variant A/- delins
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 1.000 1 2017 2017
dbSNP: rs1555639411
rs1555639411
0.790 0.360 17 67894102 frameshift variant -/G delins
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 1.000 1 2017 2017
dbSNP: rs375002796
rs375002796
0.851 0.160 7 76058047 missense variant C/T snv 5.2E-05 2.8E-05
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 1.000 1 2017 2017
dbSNP: rs776679653
rs776679653
0.827 0.200 9 86266174 missense variant C/T snv 4.2E-06
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 1.000 1 2017 2017
dbSNP: rs782736894
rs782736894
0.827 0.280 17 67975841 missense variant T/C;G snv 4.0E-06 7.0E-06
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 1.000 1 2017 2017
dbSNP: rs1114167303
rs1114167303
SON
0.925 0.120 21 33553079 frameshift variant GGTAT/- delins
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 1.000 1 2016 2016
dbSNP: rs1555743003
rs1555743003
0.701 0.520 18 33740444 splice donor variant G/A snv
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 1.000 1 2016 2016
dbSNP: rs372949028
rs372949028
0.827 0.240 22 20061684 splice donor variant G/A;C snv 7.1E-05 5.6E-05
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 1.000 1 2016 2016
dbSNP: rs752746786
rs752746786
0.742 0.560 1 1806503 missense variant A/C;G;T snv 4.0E-06
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 1.000 1 2016 2016
dbSNP: rs863224229
rs863224229
0.925 0.200 9 133356441 start lost ACCGCCGCCATCGCACCCGGCCCC/- delins
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 1.000 1 2016 2016
dbSNP: rs869312822
rs869312822
0.827 0.200 1 1806514 missense variant A/C snv
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 1.000 1 2016 2016
dbSNP: rs869312824
rs869312824
0.827 0.200 1 1804565 missense variant A/G snv
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 1.000 1 2016 2016
dbSNP: rs886039773
rs886039773
SON
0.925 0.120 21 33554982 frameshift variant TTAG/- delins
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 1.000 1 2016 2016
dbSNP: rs886039777
rs886039777
0.925 0.120 21 33549517 stop gained C/T snv
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 1.000 1 2016 2016
dbSNP: rs886039778
rs886039778
SON
0.925 0.120 21 33552303 frameshift variant -/A delins
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 1.000 1 2016 2016
dbSNP: rs886039779
rs886039779
SON
0.925 0.120 21 33557227 frameshift variant C/- delins
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 1.000 1 2016 2016
dbSNP: rs387907144
rs387907144
0.716 0.600 6 157181056 stop gained C/A;T snv
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 1.000 2 2012 2015